Online Inquiry
TRAF4 cDNA ORF Clone, Human, untagged
SPD-15147
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human TNF receptor associated factor 4. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TRAF4 |
| Gene Abbr. | TRAF4 |
| Gene ID | 9618 |
| Full Name | TNF receptor associated factor 4 |
| Alias | CART1, MLN62, RNF83 |
| Introduction | This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined. [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human TNF receptor associated factor 4. |
| NCBI Ref Seq | NM_004295.3 |
| RefSeq ORF Size | 1413 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 1.41kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.