TRAF3IP2 Knockout Cell Line - CD BioSciences

service-banner

TRAF3IP2 Knockout Cell Line

TRAF3IP2 Knockout Cell Line

SPL-03699

Size Price
1 Unit Online Inquiry
Description
23bp deletion
Target Information
Target Name TRAF3IP2
Gene Abbr. TRAF3IP2
Gene ID 10758
Full Name TRAF3 interacting protein 2
Alias ACT1, C6orf2, C6orf4, C6orf5, C6orf6
Species Human
Genomic Locus chr6:111591819
Transcript NM_147686
WT Expression Level 8.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of TRAF3IP2.
Description 23bp deletion
Parental Cell Line C631
Guide RNA Sequence CCTCCAGAACTTGAGTGCGC
PCR Primer Forward: TACCAGCCATTGATTACGTTTTTCC
Reverse: CTCCAAATATAAGGAACATGGCACC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.