Online Inquiry
TRAF3IP2 Knockout Cell Line
SPL-03699
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | TRAF3IP2 |
| Gene Abbr. | TRAF3IP2 |
| Gene ID | 10758 |
| Full Name | TRAF3 interacting protein 2 |
| Alias | ACT1, C6orf2, C6orf4, C6orf5, C6orf6 |
| Species | Human |
| Genomic Locus | chr6:111591819 |
| Transcript | NM_147686 |
| WT Expression Level | 8.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of TRAF3IP2. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCTCCAGAACTTGAGTGCGC |
| PCR Primer |
Forward: TACCAGCCATTGATTACGTTTTTCC Reverse: CTCCAAATATAAGGAACATGGCACC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.