TRAF2 Knockout Cell Line - CD BioSciences

service-banner

TRAF2 Knockout Cell Line

TRAF2 Knockout Cell Line

SPL-03698

Size Price
1 Unit Online Inquiry
Description
20bp deletion
Target Information
Target Name TRAF2
Gene Abbr. TRAF2
Gene ID 7186
Full Name TNF receptor associated factor 2
Alias MGC:45012, RNF117, TRAP, TRAP3
Species Human
Genomic Locus chr9:136898850
Transcript NM_021138
WT Expression Level 19.34 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of TRAF2.
Description 20bp deletion
Parental Cell Line C631
Guide RNA Sequence CCTGCGGAGGACGTTTCTGC
PCR Primer Forward: GACTGTTCTGGAATTGAGGTGTAAC
Reverse: TGGCTCTAAAACCAGCCTAGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.