Online Inquiry
TRAF1 cDNA ORF Clone, Human, N-HA tag
SPD-15142
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human TNF receptor-associated factor 1 with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TRAF1 |
Gene Abbr. | TRAF1 |
Gene ID | 7185 |
Full Name | TNF receptor associated factor 1 |
Alias | EBI6, MGC:10353 |
Introduction | TRAFs (TNF receptor-associated factors) are a family of multifunctional adaptor proteins that bind to surface receptors and recruit additional proteins to form multiprotein signaling complexes capable of promoting cellular responses. Members of the TRAF family share a common carboxy-terminal "TRAF domain", which mediates interactions with associated proteins; many also contain amino-terminal Zinc/RING finger motifs. The first TRAFs identified, TRAF1 and TRAF2, were found by virtue of their interactions with the cytoplasmic domain of TNF-receptor 2 (TNFRII). The six known TRAFs (TRAF1-6) act as adaptor proteins for a wide range of cell surface receptors and participate in the regulation of cell survival, proliferation, differentiation, and stress responses.TRAF2 is phosphorylated at Ser11 by IKK-ε, promoting K63-linked ubiquitination, NF-κB activation, and cellular transformation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human TNF receptor-associated factor 1 with N terminal HA tag. |
NCBI Ref Seq | NM_005658.3 |
RefSeq ORF Size | 1251 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.