TRAF1 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

TRAF1 cDNA ORF Clone, Human, C-FLAG tag

TRAF1 cDNA ORF Clone, Human, C-FLAG tag

SPD-15134

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human TNF receptor-associated factor 1 with C terminal Flag tag.
Target Information
Species Human
Target Name TRAF1
Gene Abbr. TRAF1
Gene ID 7185
Full Name TNF receptor associated factor 1
Alias EBI6, MGC:10353
Introduction TRAFs (TNF receptor-associated factors) are a family of multifunctional adaptor proteins that bind to surface receptors and recruit additional proteins to form multiprotein signaling complexes capable of promoting cellular responses. Members of the TRAF family share a common carboxy-terminal "TRAF domain", which mediates interactions with associated proteins; many also contain amino-terminal Zinc/RING finger motifs. The first TRAFs identified, TRAF1 and TRAF2, were found by virtue of their interactions with the cytoplasmic domain of TNF-receptor 2 (TNFRII). The six known TRAFs (TRAF1-6) act as adaptor proteins for a wide range of cell surface receptors and participate in the regulation of cell survival, proliferation, differentiation, and stress responses.TRAF2 is phosphorylated at Ser11 by IKK-ε, promoting K63-linked ubiquitination, NF-κB activation, and cellular transformation.
Product Details
Description Full length Clone DNA of Human TNF receptor-associated factor 1 with C terminal Flag tag.
NCBI Ref Seq NM_005658.3
RefSeq ORF Size 1290 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.29kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.