TRADD cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

TRADD cDNA ORF Clone, Human, N-HA tag

TRADD cDNA ORF Clone, Human, N-HA tag

SPD-15132

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human TNFRSF1A-associated via death domain with N terminal HA tag.
Target Information
Species Human
Target Name TRADD
Gene Abbr. TRADD
Gene ID 8717
Full Name TNFRSF1A associated via death domain
Alias Hs.89862
Introduction Apoptosis mediated by death factors like FasL and TNF-α involves the formation of a death-inducing signaling complex (DISC) to their respective receptors. Upon ligand activation to their receptors, Fas and TNF-R1 associate with death domain (DD) containing adaptor proteins FADD (Fas associated death domain) and TRADD (TNF-R1 associated death domain). In addition to its carboxy-terminal DD, FADD contains an amino-terminal death effector domain (DED) that binds to DEDs found on caspase-8 which leads to activation of this initiator caspase. Caspase-8 subsequently activates downstream effector caspases, like caspase-3, resulting in the cleavage of proteins involved in the execution of apoptosis. Unlike FADD, TRADD does not contain a DED. Apoptosis driven by TNF-R1 binding to TRADD involves association of TRADD and FADD which then leads to activation of caspase-8.
Product Details
Description Full length Clone DNA of Human TNFRSF1A-associated via death domain with N terminal HA tag.
NCBI Ref Seq BC004491
RefSeq ORF Size 939 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.