Online Inquiry
TRADD cDNA ORF Clone, Human, C-His tag
SPD-15125
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human TNFRSF1A-associated via death domain with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TRADD |
Gene Abbr. | TRADD |
Gene ID | 8717 |
Full Name | TNFRSF1A associated via death domain |
Alias | Hs.89862 |
Introduction | Apoptosis mediated by death factors like FasL and TNF-α involves the formation of a death-inducing signaling complex (DISC) to their respective receptors. Upon ligand activation to their receptors, Fas and TNF-R1 associate with death domain (DD) containing adaptor proteins FADD (Fas associated death domain) and TRADD (TNF-R1 associated death domain). In addition to its carboxy-terminal DD, FADD contains an amino-terminal death effector domain (DED) that binds to DEDs found on caspase-8 which leads to activation of this initiator caspase. Caspase-8 subsequently activates downstream effector caspases, like caspase-3, resulting in the cleavage of proteins involved in the execution of apoptosis. Unlike FADD, TRADD does not contain a DED. Apoptosis driven by TNF-R1 binding to TRADD involves association of TRADD and FADD which then leads to activation of caspase-8. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human TNFRSF1A-associated via death domain with C terminal His tag. |
NCBI Ref Seq | BC004491 |
RefSeq ORF Size | 939 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.