Online Inquiry
TPMT Knockout Cell Line
SPL-03694
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
22bp deletion |
Target Information | |
---|---|
Target Name | TPMT |
Gene Abbr. | TPMT |
Gene ID | 7172 |
Full Name | thiopurine S-methyltransferase |
Alias | TPMTD |
Species | Human |
Genomic Locus | chr6:18147832 |
Transcript | NM_000367 |
WT Expression Level | 9.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X. [provided by RefSeq, Aug 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of TPMT. |
Description | 22bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TCAACCGCTTTTCCGCAAAG |
PCR Primer |
Forward: ACCTGTTTCTGTTGTTTCTTACTGT Reverse: AACTGCTTATTAAGGTTGTTGGGAA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.