TP53I3 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

TP53I3 cDNA ORF Clone, Human, untagged

TP53I3 cDNA ORF Clone, Human, untagged

SPD-15072

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor protein p53 inducible protein 3.
Target Information
Species Human
Target Name TP53I3
Gene Abbr. TP53I3
Gene ID 9540
Full Name tumor protein p53 inducible protein 3
Alias PIG3
Product Details
Description Full length Clone DNA of Human tumor protein p53 inducible protein 3.
NCBI Ref Seq BC000474
RefSeq ORF Size 999 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.