TP53BP2 Knockout Cell Line - CD BioSciences

service-banner

TP53BP2 Knockout Cell Line

TP53BP2 Knockout Cell Line

SPL-03689

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name TP53BP2
Gene Abbr. TP53BP2
Gene ID 7159
Full Name tumor protein p53 binding protein 2
Alias 53BP2, ASPP2, BBP, P53BP2, PPP1R13A
Species Human
Genomic Locus chr1:223804207
Transcript NM_001031685
WT Expression Level 49.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of TP53BP2.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence GAGAGCACTTAAAGGCCACG
PCR Primer Forward: CTGCAGCATCAAAACTGCAGTAAAT
Reverse: TTTTTGAAACAACAAGATCAGCGAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.