Online Inquiry
TP53BP2 Knockout Cell Line
SPL-03687
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
121bp insertion |
Target Information | |
---|---|
Target Name | TP53BP2 |
Gene Abbr. | TP53BP2 |
Gene ID | 7159 |
Full Name | tumor protein p53 binding protein 2 |
Alias | 53BP2, ASPP2, BBP, P53BP2, PPP1R13A |
Species | Human |
Genomic Locus | chr1:223804207 |
Transcript | NM_001031685 |
WT Expression Level | 49.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 121bp insertion in a coding exon of TP53BP2. |
Description | 121bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GAGAGCACTTAAAGGCCACG |
PCR Primer |
Forward: CTGCAGCATCAAAACTGCAGTAAAT Reverse: TTTTTGAAACAACAAGATCAGCGAC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.