TP53AIP1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

TP53AIP1 cDNA ORF Clone, Human, untagged

TP53AIP1 cDNA ORF Clone, Human, untagged

SPD-15062

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor protein p53 regulated apoptosis inducing protein 1.
Target Information
Species Human
Target Name TP53AIP1
Gene Abbr. TP53AIP1
Gene ID 63970
Full Name tumor protein p53 regulated apoptosis inducing protein 1
Alias P53AIP1
Product Details
Description Full length Clone DNA of Human tumor protein p53 regulated apoptosis inducing protein 1.
NCBI Ref Seq BC069399
RefSeq ORF Size 327 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.