TP53 cDNA ORF Clone, Cynomolgus, N-His tag - CD BioSciences

service-banner

TP53 cDNA ORF Clone, Cynomolgus, N-His tag

TP53 cDNA ORF Clone, Cynomolgus, N-His tag

SPD-11000

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Cynomolgus tumor protein p53 with N terminal His tag.
Target Information
Species Cynomolgus
Target Name P53
Gene Abbr. TP53
Gene ID 102135998
Full Name tumor protein p53
Introduction The p53 tumor suppressor protein plays a major role in cellular response to DNA damage and other genomic aberrations. Activation of p53 can lead to either cell cycle arrest and DNA repair or apoptosis. p53 is phosphorylated at multiple sites in vivo and by several different protein kinases in vitro. DNA damage induces phosphorylation of p53 at Ser15 and Ser20 and leads to a reduced interaction between p53 and its negative regulator, the oncoprotein MDM2. MDM2 inhibits p53 accumulation by targeting it for ubiquitination and proteasomal degradation. p53 can be phosphorylated by ATM, ATR, and DNA-PK at Ser15 and Ser37. Phosphorylation impairs the ability of MDM2 to bind p53, promoting both the accumulation and activation of p53 in response to DNA damage. Chk2 and Chk1 can phosphorylate p53 at Ser20, enhancing its tetramerization, stability, and activity. p53 is phosphorylated at Ser392 in vivo and by CAK in vitro. Phosphorylation of p53 at Ser392 is increased in human tumors and has been reported to influence the growth suppressor function, DNA binding, and transcriptional activation of p53. p53 is phosphorylated at Ser6 and Ser9 by CK1δ and CK1ε both in vitro and in vivo. Phosphorylation of p53 at Ser46 regulates the ability of p53 to induce apoptosis. Acetylation of p53 is mediated by p300 and CBP acetyltransferases. Inhibition of deacetylation suppressing MDM2 from recruiting HDAC1 complex by p19 (ARF) stabilizes p53. Acetylation appears to play a positive role in the accumulation of p53 protein in stress response. Following DNA damage, human p53 becomes acetylated at Lys382 (Lys379 in mouse) in vivo to enhance p53-DNA binding. Deacetylation of p53 occurs through interaction with the SIRT1 protein, a deacetylase that may be involved in cellular aging and the DNA damage response.
Product Details
Description Full length Clone DNA of Cynomolgus tumor protein p53 with N terminal His tag.
NCBI Ref Seq AF456343.1
RefSeq ORF Size 1182 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.