TOP1MT Knockout Cell Line - CD BioSciences

service-banner

TOP1MT Knockout Cell Line

TOP1MT Knockout Cell Line

SPL-03678

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name TOP1MT
Gene Abbr. TOP1MT
Gene ID 116447
Full Name DNA topoisomerase I mitochondrial
Species Human
Genomic Locus chr8:143326263
Transcript NM_052963
WT Expression Level 38.82 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a mitochondrial DNA topoisomerase that plays a role in the modification of DNA topology. The encoded protein is a type IB topoisomerase and catalyzes the transient breaking and rejoining of DNA to relieve tension and DNA supercoiling generated in the mitochondrial genome during replication and transcription. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of TOP1MT.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence CCACAGATACTTTGTGGACA
PCR Primer Forward: GAGAAAAGAGCAGCTTTGTGAGAA
Reverse: AGGTTCTGCCTATTGCACACAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.