Online Inquiry
TOP1MT Knockout Cell Line
SPL-03677
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | TOP1MT |
| Gene Abbr. | TOP1MT |
| Gene ID | 116447 |
| Full Name | DNA topoisomerase I mitochondrial |
| Species | Human |
| Genomic Locus | chr8:143326263 |
| Transcript | NM_052963 |
| WT Expression Level | 38.82 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a mitochondrial DNA topoisomerase that plays a role in the modification of DNA topology. The encoded protein is a type IB topoisomerase and catalyzes the transient breaking and rejoining of DNA to relieve tension and DNA supercoiling generated in the mitochondrial genome during replication and transcription. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of TOP1MT. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCACAGATACTTTGTGGACA |
| PCR Primer |
Forward: GAGAAAAGAGCAGCTTTGTGAGAA Reverse: AGGTTCTGCCTATTGCACACAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.