Online Inquiry
Tnfsf9 cDNA ORF Clone, Rat, C-FLAG tag
SPD-00223
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 9 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | 4-1BBL |
Gene Abbr. | Tnfsf9 |
Gene ID | 353218 |
Full Name | TNF superfamily member 9 |
Alias | Tnlg5a |
Introduction | 4-1BB ligand (4-1BBL) is a type II transmembrane glycoprotein belonging to the TNF superfamily (TNFSF) and has been designated TNFSF9. Mouse 4-1BBL cDNA encodes a 309 amino acid residues (aa) protein with an 82 aa N-terminal cytoplasmic domain, a 21 aa transmembrane domain and a 206 aa C-terminal extracellular domain. The extracellular domain of 4-1BBL has a tertiary structure similar to that of other TNFSF members, but shares only low aa sequence homology (14‑16%). Murine 4-1BBL shares 36% aa sequence identity with its human counterpart. 4-1BBL is predominantly expressed on activated antigen presenting cells (APCs) such as B cells, macrophages and dendritic cells (DCs). It is also expressed on most T and B lymphoma cell lines. A soluble 4-1BBL is released from the cell surface following cellular activation via proteolytic cleavage by one or more sheddases. By analogy to other TNFSF ligands, both the soluble and transmembrane 4-1BBL are expected to exist as non-covalent homotrimers. 4-1BBL binds 4-1BB, a TNF receptor superfamily member, TNFRSF9, which is also known as CD137 and ILA (induced by lymphocyte activation). 4-1BB is expressed on activated CD4+ and CD8+ T cells, thymocytes, and NK cells. It is also expressed on monocytes, neutrophils, DCs and eosinophils. In response to 4-1BBL binding, 4-1BB transduces a T cell costimulatory signal in both CD4+ and CD8+ T cells to promote survival and enhance proliferation, cytokine production and effector function. In dendritic cells, 4-1BB is a DC-activating molecule that enhances cytokine production and up‑regulates expression of B7-1 and B7-2 costimulatory molecules. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 9 with C terminal Flag tag. |
NCBI Ref Seq | NM_181384.2 |
RefSeq ORF Size | 966 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + XbaI (6kb + 0.97kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.