Tnfsf9 cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Tnfsf9 cDNA ORF Clone, Mouse, N-Myc tag

Tnfsf9 cDNA ORF Clone, Mouse, N-Myc tag

SPD-00232

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 9 with N terminal Myc tag.
Target Information
Species Mouse
Target Name 4-1BBL
Gene Abbr. Tnfsf9
Gene ID 21950
Full Name tumor necrosis factor (ligand) superfamily, member 9
Alias 4-1BB, 4-1BB-, 4-1BB-L, 4-1BBL, AI848817
Introduction 4-1BB ligand (4-1BBL) is a type II transmembrane glycoprotein belonging to the TNF superfamily (TNFSF) and has been designated TNFSF9. Mouse 4-1BBL cDNA encodes a 309 amino acid residues (aa) protein with an 82 aa N-terminal cytoplasmic domain, a 21 aa transmembrane domain and a 206 aa C-terminal extracellular domain. The extracellular domain of 4-1BBL has a tertiary structure similar to that of other TNFSF members, but shares only low aa sequence homology (14‑16%). Murine 4-1BBL shares 36% aa sequence identity with its human counterpart. 4-1BBL is predominantly expressed on activated antigen presenting cells (APCs) such as B cells, macrophages and dendritic cells (DCs). It is also expressed on most T and B lymphoma cell lines. A soluble 4-1BBL is released from the cell surface following cellular activation via proteolytic cleavage by one or more sheddases. By analogy to other TNFSF ligands, both the soluble and transmembrane 4-1BBL are expected to exist as non-covalent homotrimers. 4-1BBL binds 4-1BB, a TNF receptor superfamily member, TNFRSF9, which is also known as CD137 and ILA (induced by lymphocyte activation). 4-1BB is expressed on activated CD4+ and CD8+ T cells, thymocytes, and NK cells. It is also expressed on monocytes, neutrophils, DCs and eosinophils. In response to 4-1BBL binding, 4-1BB transduces a T cell costimulatory signal in both CD4+ and CD8+ T cells to promote survival and enhance proliferation, cytokine production and effector function. In dendritic cells, 4-1BB is a DC-activating molecule that enhances cytokine production and up‑regulates expression of B7-1 and B7-2 costimulatory molecules.
Product Details
Description Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 9 with N terminal Myc tag.
NCBI Ref Seq NM_009404.3
RefSeq ORF Size 930 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.