TNFSF9 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

TNFSF9 cDNA ORF Clone, Human, C-FLAG tag

TNFSF9 cDNA ORF Clone, Human, C-FLAG tag

SPD-00236

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 9 with C terminal Flag tag.
Target Information
Species Human
Target Name 4-1BBL
Gene Abbr. TNFSF9
Gene ID 8744
Full Name TNF superfamily member 9
Alias 4-1BB-L, CD137L, TNLG5A
Introduction 4-1BB ligand (4-1BBL) is a type II transmembrane glycoprotein belonging to the TNF superfamily (TNFSF) and has been designated TNFSF9. Mouse 4-1BBL cDNA encodes a 309 amino acid residues (aa) protein with an 82 aa N-terminal cytoplasmic domain, a 21 aa transmembrane domain and a 206 aa C-terminal extracellular domain. The extracellular domain of 4-1BBL has a tertiary structure similar to that of other TNFSF members, but shares only low aa sequence homology (14‑16%). Murine 4-1BBL shares 36% aa sequence identity with its human counterpart. 4-1BBL is predominantly expressed on activated antigen presenting cells (APCs) such as B cells, macrophages and dendritic cells (DCs). It is also expressed on most T and B lymphoma cell lines. A soluble 4-1BBL is released from the cell surface following cellular activation via proteolytic cleavage by one or more sheddases. By analogy to other TNFSF ligands, both the soluble and transmembrane 4-1BBL are expected to exist as non-covalent homotrimers. 4-1BBL binds 4-1BB, a TNF receptor superfamily member, TNFRSF9, which is also known as CD137 and ILA (induced by lymphocyte activation). 4-1BB is expressed on activated CD4+ and CD8+ T cells, thymocytes, and NK cells. It is also expressed on monocytes, neutrophils, DCs and eosinophils. In response to 4-1BBL binding, 4-1BB transduces a T cell costimulatory signal in both CD4+ and CD8+ T cells to promote survival and enhance proliferation, cytokine production and effector function. In dendritic cells, 4-1BB is a DC-activating molecule that enhances cytokine production and up‑regulates expression of B7-1 and B7-2 costimulatory molecules.
Product Details
Description Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 9 with C terminal Flag tag.
NCBI Ref Seq NM_003811.3
RefSeq ORF Size 804 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.80kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.