Online Inquiry
Tnfsf8 cDNA ORF Clone, Rat, N-His tag
SPD-02877
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 8 with N terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | CD30L |
Gene Abbr. | Tnfsf8 |
Gene ID | 683163 |
Full Name | TNF superfamily member 8 |
Alias | Tnlg3a |
Introduction | CD30 ligand (CD30L)/TNFSF8 is a type II membrane protein belonging to the TNF superfamily. CD30L is expressed on the cell surface of activated T cells, B cells, and monocytes. The protein is also constitutively expressed on granulocytes and medullary thymic epithelial cells. The specific receptor for CD30L is CD30/TNFRSF8, a type I transmembrane glycoprotein belonging to the TNF receptor superfamily. CD30 was originally identified as a cell surface antigen of Hodgkin's and Reed-Sternberg cells using the monoclonal antibody Ki-1. CD30 is also expressed on different non-Hodgkin's lymphomas, virus-infected T and B cells, and on normal T and B cells after activation. Among T cells, CD30 is preferentially expressed on a subset of T cells producing Th2-type cytokines and on CD4+/CD8+ thymocytes that coexpress CD45RO and IL-4 receptor. CD30 ligation by CD30L mediates pleiotropic effects including cell proliferation, activation, differentiation and cell death by apoptosis. CD30 can act as a costimulatory molecule in thymic negative selection and may also play a critical role in the pathophysiology of Hodgkin's disease and other CD30+ lymphomas. Human and mouse CD30 ligand cDNAs share 70% sequence homology. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 8 with N terminal His tag. |
NCBI Ref Seq | XM_001064723.2 |
RefSeq ORF Size | 714 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.