Online Inquiry
Tnfsf4 cDNA ORF Clone, Mouse, C-Myc tag
SPD-10869
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 4 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | OX40L |
Gene Abbr. | Tnfsf4 |
Gene ID | 22164 |
Full Name | tumor necrosis factor (ligand) superfamily, member 4 |
Alias | Ath, Ath-, Ath-1, Ath1, CD134 |
Introduction | OX40 Ligand (OX40L), also known as gp34, is a type II transmembrane glycoprotein designated TNFSF4 within the TNF superfamily. Human OX40L cDNA encodes a 183 amino acids (aa) polypeptide with an amino-terminal cytoplasmic domain (aa 1-23) and a carboxy-terminal extracellular domain (aa 51-183). It shares 46% aa sequence identity with the mouse counterpart. OX40L is expressed on the surface of activated B cells, T cells, dendritic cells and endothelial cells. Like other TNF superfamily members, membrane-bound OX40 Ligand exists as a homotrimer. OX40L binds to OX40 (CD134), a member of the TNF receptor superfamily that is expressed predominantly on activated CD4+ T cells. OX40 Ligand is one of the group of co-stimulatory molecules in the immune system that includes B7, CD40 Ligand, CD30 Ligand, CD27 Ligand and 4-1BB Ligand. OX40 appears as a late activation-induced T cell surface antigen, and its major function of OX40-OX40L interaction may be to transmit a late co-stimulatory signal to promote the survival and proliferation of activated CD4+ T cells and prolong the immune response. Engagement of OX40 on activated T cells in situ in tumors has been shown to augment immune responses and subsequent tumor regression. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 4 with C terminal Myc tag. |
NCBI Ref Seq | NM_009452.2 |
RefSeq ORF Size | 597 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.