TNFSF4 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

TNFSF4 cDNA ORF Clone, Human, C-His tag

TNFSF4 cDNA ORF Clone, Human, C-His tag

SPD-10878

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 4 with C terminal His tag.
Target Information
Species Human
Target Name OX40L
Gene Abbr. TNFSF4
Gene ID 7292
Full Name TNF superfamily member 4
Alias CD134L, CD252, GP34, OX-40L, OX4OL
Introduction OX40 Ligand (OX40L), also known as gp34, is a type II transmembrane glycoprotein designated TNFSF4 within the TNF superfamily. Human OX40L cDNA encodes a 183 amino acids (aa) polypeptide with an amino-terminal cytoplasmic domain (aa 1-23) and a carboxy-terminal extracellular domain (aa 51-183). It shares 46% aa sequence identity with the mouse counterpart. OX40L is expressed on the surface of activated B cells, T cells, dendritic cells and endothelial cells. Like other TNF superfamily members, membrane-bound OX40 Ligand exists as a homotrimer. OX40L binds to OX40 (CD134), a member of the TNF receptor superfamily that is expressed predominantly on activated CD4+ T cells. OX40 Ligand is one of the group of co-stimulatory molecules in the immune system that includes B7, CD40 Ligand, CD30 Ligand, CD27 Ligand and 4-1BB Ligand. OX40 appears as a late activation-induced T cell surface antigen, and its major function of OX40-OX40L interaction may be to transmit a late co-stimulatory signal to promote the survival and proliferation of activated CD4+ T cells and prolong the immune response. Engagement of OX40 on activated T cells in situ in tumors has been shown to augment immune responses and subsequent tumor regression.
Product Details
Description Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 4 with C terminal His tag.
NCBI Ref Seq NM_003326.3
RefSeq ORF Size 552 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.6kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.