Online Inquiry
TNFSF18 cDNA ORF Clone, Human, N-Myc tag
SPD-06108
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | GITRL |
Gene Abbr. | TNFSF18 |
Gene ID | 8995 |
Full Name | TNF superfamily member 18 |
Alias | AITRL, GITRL, TL6, TNLG2A, hGITRL |
Introduction | GITR (glucocorticoid-induced TNF receptor superfamily-related protein, also named AITR, activation-inducible TNF receptor superfamily-related protein) and GITR Ligand (GITRL) are novel members of the TNF receptor (TNFR) and TNF superfamilies (SF) that have been designated TNFRSF18 and TNFSF18, respectively. Human GITR Ligand cDNA encodes a 177 amino acid type II membrane protein. The carboxy-terminal extracellular domain shows sequence identity to TNF/TNFSF2 (21%), Fas ligand/TNFSF6 (21%), TRAIL/TNFSF10 (18%), and lymphotoxin alpha /TNFSF1 (18%). GITR Ligand is constitutively expressed in human umbilical vein endothelial cells but is not expressed in resting or stimulated T cell lines, B cell lines or peripheral blood mononuclear cells. GITR, the receptor for GITR Ligand, is expressed at low levels in peripheral blood T cells, bone marrow, thymus, spleen and lymph nodes. In contrast to mouse GITR, expression of human GITR is not induced by treatment with dexamethasone, but is up-regulated by antigen-receptor stimulation or by treatment with soluble anti-CD3 plus anti-CD28 or PMA plus ionomycin. Ligation of GITR has been found to induce nuclear factor (NF)-kappa B activation via TNF receptor-associated factor 2 and protect cells from TCR activation-induced cell death. It has been proposed that GITR Ligand and GITR may modulate T lymphocyte functions in peripheral tissues. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 18 with N terminal Myc tag. |
NCBI Ref Seq | NM_005092.3 |
RefSeq ORF Size | 600 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.