TNFSF15 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

TNFSF15 cDNA ORF Clone, Human, N-Myc tag

TNFSF15 cDNA ORF Clone, Human, N-Myc tag

SPD-14686

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 15 with N terminal Myc tag.
Target Information
Species Human
Target Name TL1A
Gene Abbr. TNFSF15
Gene ID 9966
Full Name TNF superfamily member 15
Alias TL1, TL1A, TNLG1B, VEGI, VEGI192A
Introduction TL1A is a type II transmembrane protein belonging to the TNF superfamily and has been designated TNF superfamily member 15 (TNFSF15). Human TL1A is a 251 aa protein consisting of a 35 aa cytoplasmic domain, a 24 aa transmembrane region and a 192 aa C-terminal extracellular domain. It is a longer variant of the previously cloned TL1 (also known as VEGI) that is possibly a cloning artifact. TL1A is predominantly expressed in endothelial cells and its expression is inducible by TNF-alpha and IL-1 alpha. TL1A binds with high affinity to death receptor 3 (DR3), which is now designated TNF receptor superfamily member 25 (TNFRSF25). DR3 was formerly designated TNFRSF12 when it was thought to be the receptor for TWEAK/TNFSF12. DR3 is expressed primarily on activated T cells. Depending on the cell context, ligation of DR3 by TL1A can trigger one of two signaling pathways, activation of the transcription factor NF-kappa-B or activation of caspases and apoptosis. On primary T cells, TL1A induces NF-kappa-B activation and a costimulatory signal to increase IL-2 responsiveness and the secretion of proinflammatory cytokines. However, in a tumor cell line, TF-1, TL1A has been shown to induce caspase activity and apoptosis. These effects of TL1A are blocked by the secreted, soluble decoy receptor 3 (DcR3), also known as TR6 and TNFRSF6B, which compete with DR3 for binding to TL1A. Consistent with the observed in vitro activities, TL1A promotes ex vivo splenocyte expansion and enhances in vivo graft-versus-host-response.
Product Details
Description Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 15 with N terminal Myc tag.
NCBI Ref Seq NM_005118.3
RefSeq ORF Size 756 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.