Tnfsf14 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Tnfsf14 cDNA ORF Clone, Mouse, untagged

Tnfsf14 cDNA ORF Clone, Mouse, untagged

SPD-09729

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 14.
Target Information
Species Mouse
Target Name LIGHT
Gene Abbr. Tnfsf14
Gene ID 50930
Full Name tumor necrosis factor (ligand) superfamily, member 14
Alias HVEM, HVEM-L, HVEML, LIG, LIGHT
Introduction Human LIGHT, also known as TNFSF14, is a type II membrane protein that is a member of the TNF superfamily. LIGHT is an acronym which stands for "is homologous to lymphotoxins, exhibits inducible expression, and competes with HSV glycoprotein D for HVEM, a receptor expressed by T lymphocytes". LIGHT has also been called HVEM-L and LT-gamma. LIGHT is a 240 amino acid (aa) protein that contains a 37 aa cytoplasmic domain, a 22 aa transmembrane region, and a 181 aa extracellular domain. Similar to other TNF ligand family members, LIGHT is predicted to assemble as a homotrimer. LIGHT is produced by activated T cells and was first identified by its ability to compete with HSV glycoprotein D for HVEM binding. LIGHT has also been shown to bind to the lymphotoxin beta receptor (LT beta R) and the decoy receptor (DcR3/TR6). LIGHT overexpression in tumor cells induces apoptosis, which can be enhanced by IFN-gamma.
Product Details
Description Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 14.
NCBI Ref Seq NM_019418.2
RefSeq ORF Size 720 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.72kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.