Online Inquiry
Tnfsf14 cDNA ORF Clone, Mouse, C-His tag
SPD-09721
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 14 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | LIGHT |
| Gene Abbr. | Tnfsf14 |
| Gene ID | 50930 |
| Full Name | tumor necrosis factor (ligand) superfamily, member 14 |
| Alias | HVEM, HVEM-L, HVEML, LIG, LIGHT |
| Introduction | Human LIGHT, also known as TNFSF14, is a type II membrane protein that is a member of the TNF superfamily. LIGHT is an acronym which stands for "is homologous to lymphotoxins, exhibits inducible expression, and competes with HSV glycoprotein D for HVEM, a receptor expressed by T lymphocytes". LIGHT has also been called HVEM-L and LT-gamma. LIGHT is a 240 amino acid (aa) protein that contains a 37 aa cytoplasmic domain, a 22 aa transmembrane region, and a 181 aa extracellular domain. Similar to other TNF ligand family members, LIGHT is predicted to assemble as a homotrimer. LIGHT is produced by activated T cells and was first identified by its ability to compete with HSV glycoprotein D for HVEM binding. LIGHT has also been shown to bind to the lymphotoxin beta receptor (LT beta R) and the decoy receptor (DcR3/TR6). LIGHT overexpression in tumor cells induces apoptosis, which can be enhanced by IFN-gamma. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 14 with C terminal His tag. |
| NCBI Ref Seq | NM_019418.2 |
| RefSeq ORF Size | 720 bp |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.