TNFSF14 cDNA ORF Clone, Cynomolgus, N-FLAG tag - CD BioSciences

service-banner

TNFSF14 cDNA ORF Clone, Cynomolgus, N-FLAG tag

TNFSF14 cDNA ORF Clone, Cynomolgus, N-FLAG tag

SPD-09745

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Cynomolgus tumor necrosis factor (ligand) superfamily, member 14 with N terminal Flag tag.
Target Information
Species Cynomolgus
Target Name LIGHT
Gene Abbr. TNFSF14
Gene ID 102130835
Full Name TNF superfamily member 14
Introduction Human LIGHT, also known as TNFSF14, is a type II membrane protein that is a member of the TNF superfamily. LIGHT is an acronym which stands for "is homologous to lymphotoxins, exhibits inducible expression, and competes with HSV glycoprotein D for HVEM, a receptor expressed by T lymphocytes". LIGHT has also been called HVEM-L and LT-gamma. LIGHT is a 240 amino acid (aa) protein that contains a 37 aa cytoplasmic domain, a 22 aa transmembrane region, and a 181 aa extracellular domain. Similar to other TNF ligand family members, LIGHT is predicted to assemble as a homotrimer. LIGHT is produced by activated T cells and was first identified by its ability to compete with HSV glycoprotein D for HVEM binding. LIGHT has also been shown to bind to the lymphotoxin beta receptor (LT beta R) and the decoy receptor (DcR3/TR6). LIGHT overexpression in tumor cells induces apoptosis, which can be enhanced by IFN-gamma.
Product Details
Description Full length Clone DNA of Cynomolgus tumor necrosis factor (ligand) superfamily, member 14 with N terminal Flag tag.
NCBI Ref Seq HQ717157.1
RefSeq ORF Size 723 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.