Online Inquiry
TNFSF13B cDNA ORF Clone, Rhesus, N-FLAG tag
SPD-01391
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 13b with N terminal Flag tag. |
Target Information | |
---|---|
Species | Rhesus |
Target Name | BAFF |
Gene Abbr. | TNFSF13B |
Gene ID | 693917 |
Full Name | TNF superfamily member 13b |
Introduction | Simultaneously four different laboratories identified a new member of the tumor necrosis factor (TNF) family. This has been named as TALL-1, THANK (TNF homologue that activates apoptosis, nuclear factor-kappaB, and c-Jun NH2-terminal kinase, BAFF (for B cell activating factor belonging to the TNF family) and BLyS (B lymphocyte stimulator). Membrane-bound BLyS (BAFF) is processed and secreted through the action of a protease whose specificity matches that of the furin family of proprotein convertases. Secreted BLyS (BAFF) acts as a potent B cell growth factor. This protein is expressed abundantly in peripheral blood lymphocytes, specifically in monocytes and macrophages. BLyS (BAFF) regulation is upregulated by interferon gamma. Overexpression of BLyS (BAFF) in transgenic mice lead to increased numbers of mature B and effector T cells. These mice also develop autoimmune -like symptoms, such as high levels of rheumatoid factors, anti-DNA autoantibodies, etc.. Two receptors for BLyS (BAFF) have been identified and termed as BCMA and TACI. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 13b with N terminal Flag tag. |
NCBI Ref Seq | XM_001082247.2 |
RefSeq ORF Size | 858 bp |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.