Tnfsf13b cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Tnfsf13b cDNA ORF Clone, Mouse, N-Myc tag

Tnfsf13b cDNA ORF Clone, Mouse, N-Myc tag

SPD-01404

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 13b with N terminal Myc tag.
Target Information
Species Mouse
Target Name BAFF
Gene Abbr. Tnfsf13b
Gene ID 24099
Full Name tumor necrosis factor (ligand) superfamily, member 13b
Alias BAF, BAFF, BL, BLyS, D8Ertd387
Introduction Simultaneously four different laboratories identified a new member of the tumor necrosis factor (TNF) family. This has been named as TALL-1, THANK (TNF homologue that activates apoptosis, nuclear factor-kappaB, and c-Jun NH2-terminal kinase, BAFF (for B cell activating factor belonging to the TNF family) and BLyS (B lymphocyte stimulator). Membrane-bound BLyS (BAFF) is processed and secreted through the action of a protease whose specificity matches that of the furin family of proprotein convertases. Secreted BLyS (BAFF) acts as a potent B cell growth factor. This protein is expressed abundantly in peripheral blood lymphocytes, specifically in monocytes and macrophages. BLyS (BAFF) regulation is upregulated by interferon gamma. Overexpression of BLyS (BAFF) in transgenic mice lead to increased numbers of mature B and effector T cells. These mice also develop autoimmune -like symptoms, such as high levels of rheumatoid factors, anti-DNA autoantibodies, etc.. Two receptors for BLyS (BAFF) have been identified and termed as BCMA and TACI.
Product Details
Description Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 13b with N terminal Myc tag.
NCBI Ref Seq NM_033622.1
RefSeq ORF Size 930 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.