TNFSF13B cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

TNFSF13B cDNA ORF Clone, Human, C-FLAG tag

TNFSF13B cDNA ORF Clone, Human, C-FLAG tag

SPD-01407

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human suppressor of cytokine signaling 3 with C terminal Flag tag.
Target Information
Species Human
Target Name BAFF
Gene Abbr. TNFSF13B
Gene ID 10673
Full Name TNF superfamily member 13b
Alias BAFF, BLYS, CD257, DTL, TALL-1
Introduction Simultaneously four different laboratories identified a new member of the tumor necrosis factor (TNF) family. This has been named as TALL-1, THANK (TNF homologue that activates apoptosis, nuclear factor-kappaB, and c-Jun NH2-terminal kinase, BAFF (for B cell activating factor belonging to the TNF family) and BLyS (B lymphocyte stimulator). Membrane-bound BLyS (BAFF) is processed and secreted through the action of a protease whose specificity matches that of the furin family of proprotein convertases. Secreted BLyS (BAFF) acts as a potent B cell growth factor. This protein is expressed abundantly in peripheral blood lymphocytes, specifically in monocytes and macrophages. BLyS (BAFF) regulation is upregulated by interferon gamma. Overexpression of BLyS (BAFF) in transgenic mice lead to increased numbers of mature B and effector T cells. These mice also develop autoimmune -like symptoms, such as high levels of rheumatoid factors, anti-DNA autoantibodies, etc.. Two receptors for BLyS (BAFF) have been identified and termed as BCMA and TACI.
Product Details
Description Full length Clone DNA of Human suppressor of cytokine signaling 3 with C terminal Flag tag.
NCBI Ref Seq NM_006573.3
RefSeq ORF Size 858 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 0.9kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.