Tnfsf13 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Tnfsf13 cDNA ORF Clone, Mouse, untagged

Tnfsf13 cDNA ORF Clone, Mouse, untagged

SPD-00771

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 13, transcript variant 2.
Target Information
Species Mouse
Target Name APRIL
Gene Abbr. Tnfsf13
Gene ID 69583
Full Name tumor necrosis factor (ligand) superfamily, member 13
Alias 2310026N09Rik, April, TA, TRD, Tall2
Product Details
Description Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 13, transcript variant 2.
NCBI Ref Seq NM_001159505.1
RefSeq ORF Size 723 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.72kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.