Tnfsf12 cDNA ORF Clone, Rat, N-Myc tag - CD BioSciences

service-banner

Tnfsf12 cDNA ORF Clone, Rat, N-Myc tag

Tnfsf12 cDNA ORF Clone, Rat, N-Myc tag

SPD-15305

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat tumor necrosis factor ligand superfamily member 12 with N terminal Myc tag.
Target Information
Species Rat
Target Name TWEAK
Gene Abbr. Tnfsf12
Gene ID 360548
Full Name TNF superfamily member 12
Alias TWEAK, Tnlg4a
Introduction TWEAK (TNFSF12/Apo-3L) is a member of the TNF superfamily of cytokines that are typically involved in immune regulation, inflammation, and apoptosis. TWEAK mRNA is expressed in a variety of tissues and cell lines, with higher levels observed in the heart, brain, skeletal muscle and within the immune system. Like other family members TWEAK is a type II transmembrane protein that can also be proteolytically processed to form a soluble cytokine. Soluble TWEAK is a weak inducer of apoptosis in some cell lines. The receptor for TWEAK, known as TWEAKR or fibroblast growth factor inducible 14 (Fn14), is a relatively small member of the TNF receptor family. TWEAK signaling has been associated with apoptosis, proliferation, migration, angiogenesis, and inflammation. Recent studies have suggested some therapeutic potential of TWEAK and its receptor signaling in regards to autoimmunity, cancer, and vascular injury.
Product Details
Description Full length Clone DNA of Rat tumor necrosis factor ligand superfamily member 12 with N terminal Myc tag.
NCBI Ref Seq NM_001001513.2
RefSeq ORF Size 750 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.