Online Inquiry
Tnfsf12 cDNA ORF Clone, Rat, C-His tag
SPD-15299
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat tumor necrosis factor ligand superfamily member 12 with C terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | TWEAK |
Gene Abbr. | Tnfsf12 |
Gene ID | 360548 |
Full Name | TNF superfamily member 12 |
Alias | TWEAK, Tnlg4a |
Introduction | TWEAK (TNFSF12/Apo-3L) is a member of the TNF superfamily of cytokines that are typically involved in immune regulation, inflammation, and apoptosis. TWEAK mRNA is expressed in a variety of tissues and cell lines, with higher levels observed in the heart, brain, skeletal muscle and within the immune system. Like other family members TWEAK is a type II transmembrane protein that can also be proteolytically processed to form a soluble cytokine. Soluble TWEAK is a weak inducer of apoptosis in some cell lines. The receptor for TWEAK, known as TWEAKR or fibroblast growth factor inducible 14 (Fn14), is a relatively small member of the TNF receptor family. TWEAK signaling has been associated with apoptosis, proliferation, migration, angiogenesis, and inflammation. Recent studies have suggested some therapeutic potential of TWEAK and its receptor signaling in regards to autoimmunity, cancer, and vascular injury. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat tumor necrosis factor ligand superfamily member 12 with C terminal His tag. |
NCBI Ref Seq | NM_001001513.2 |
RefSeq ORF Size | 750 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.