Tnfsf12 cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Tnfsf12 cDNA ORF Clone, Mouse, C-His tag

Tnfsf12 cDNA ORF Clone, Mouse, C-His tag

SPD-15309

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 12 with C terminal His tag.
Target Information
Species Mouse
Target Name TWEAK
Gene Abbr. Tnfsf12
Gene ID 21944
Full Name tumor necrosis factor (ligand) superfamily, member 12
Alias A, Apo3l, DR, Dr3l, Dr3lg
Introduction TWEAK (TNFSF12/Apo-3L) is a member of the TNF superfamily of cytokines that are typically involved in immune regulation, inflammation, and apoptosis. TWEAK mRNA is expressed in a variety of tissues and cell lines, with higher levels observed in the heart, brain, skeletal muscle and within the immune system. Like other family members TWEAK is a type II transmembrane protein that can also be proteolytically processed to form a soluble cytokine. Soluble TWEAK is a weak inducer of apoptosis in some cell lines. The receptor for TWEAK, known as TWEAKR or fibroblast growth factor inducible 14 (Fn14), is a relatively small member of the TNF receptor family. TWEAK signaling has been associated with apoptosis, proliferation, migration, angiogenesis, and inflammation. Recent studies have suggested some therapeutic potential of TWEAK and its receptor signaling in regards to autoimmunity, cancer, and vascular injury.
Product Details
Description Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 12 with C terminal His tag.
NCBI Ref Seq NM_011614.1
RefSeq ORF Size 750 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.