TNFSF11 cDNA ORF Clone, Rhesus, C-His tag - CD BioSciences

service-banner

TNFSF11 cDNA ORF Clone, Rhesus, C-His tag

TNFSF11 cDNA ORF Clone, Rhesus, C-His tag

SPD-15247

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus tumornecrosisfactor(ligand)superfamily,member11 with C terminal His tag.
Target Information
Species Rhesus
Target Name TRANCE
Gene Abbr. TNFSF11
Gene ID 699955
Full Name TNF superfamily member 11
Introduction TRANCE/OPGL/RANKL/ODF is a recently identified member of tumor necrosis factor family. TRANCE (TNF-related activation-induced cytokine receptor) or RANKL {receptor activator of NF-kB (RANK) ligand} has been implicated in interactions between T cells and dendritic cells. RANK ligand (RANKL/TRANCE) binds to RANK on dendritic cells, upregulates the expression of anti-apoptotic protein BcL-XL suggesting a role in dendritic cell survival. TRANCE/RANKL is also important in T and B-cell maturation. As OPGL/ODF (Osteoprotegerin Ligand/Osteoclast differentiation factor), the same protein can both activate mature osteoclasts and mediate osteoclastogenesis. OPGL/TRANCE deficient mice show severe osteoporesis and complete absence of osteoclasts as a result of lack of osteogenesis.
Product Details
Description Full length Clone DNA of Rhesus tumornecrosisfactor(ligand)superfamily,member11 with C terminal His tag.
NCBI Ref Seq XM_001092669.2
RefSeq ORF Size 954 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.