Tnfsf11 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Tnfsf11 cDNA ORF Clone, Rat, untagged

Tnfsf11 cDNA ORF Clone, Rat, untagged

SPD-15275

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 11.
Target Information
Species Rat
Target Name TRANCE
Gene Abbr. Tnfsf11
Gene ID 117516
Full Name TNF superfamily member 11
Alias RANKL
Introduction TRANCE/OPGL/RANKL/ODF is a recently identified member of tumor necrosis factor family. TRANCE (TNF-related activation-induced cytokine receptor) or RANKL {receptor activator of NF-kB (RANK) ligand} has been implicated in interactions between T cells and dendritic cells. RANK ligand (RANKL/TRANCE) binds to RANK on dendritic cells, upregulates the expression of anti-apoptotic protein BcL-XL suggesting a role in dendritic cell survival. TRANCE/RANKL is also important in T and B-cell maturation. As OPGL/ODF (Osteoprotegerin Ligand/Osteoclast differentiation factor), the same protein can both activate mature osteoclasts and mediate osteoclastogenesis. OPGL/TRANCE deficient mice show severe osteoporesis and complete absence of osteoclasts as a result of lack of osteogenesis.
Product Details
Description Full length Clone DNA of Rat tumor necrosis factor (ligand) superfamily, member 11.
NCBI Ref Seq NM_057149.1
RefSeq ORF Size 957 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.