Tnfsf11 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Tnfsf11 cDNA ORF Clone, Mouse, C-FLAG tag

Tnfsf11 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-15256

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 11 with C terminal Flag tag.
Target Information
Species Mouse
Target Name TRANCE
Gene Abbr. Tnfsf11
Gene ID 21943
Full Name tumor necrosis factor (ligand) superfamily, member 11
Alias Ly10, Ly109l, O, OD, ODF
Introduction TRANCE/OPGL/RANKL/ODF is a recently identified member of tumor necrosis factor family. TRANCE (TNF-related activation-induced cytokine receptor) or RANKL {receptor activator of NF-kB (RANK) ligand} has been implicated in interactions between T cells and dendritic cells. RANK ligand (RANKL/TRANCE) binds to RANK on dendritic cells, upregulates the expression of anti-apoptotic protein BcL-XL suggesting a role in dendritic cell survival. TRANCE/RANKL is also important in T and B-cell maturation. As OPGL/ODF (Osteoprotegerin Ligand/Osteoclast differentiation factor), the same protein can both activate mature osteoclasts and mediate osteoclastogenesis. OPGL/TRANCE deficient mice show severe osteoporesis and complete absence of osteoclasts as a result of lack of osteogenesis.
Product Details
Description Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 11 with C terminal Flag tag.
NCBI Ref Seq NM_011613.3
RefSeq ORF Size 951 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 9 G>A and 342 C>A not causing the amino acid variation.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + XbaI (6kb + 1kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.