TNFSF11 cDNA ORF Clone, human, untagged - CD BioSciences

service-banner

TNFSF11 cDNA ORF Clone, human, untagged

TNFSF11 cDNA ORF Clone, human, untagged

SPD-15245

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 11. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Target Information
Species Human
Target Name TRANCE
Gene Abbr. TNFSF11
Gene ID 8600
Full Name TNF superfamily member 11
Alias CD254, ODF, OPGL, OPTB2, RANKL, TNLG6B, TRANCE, hRANKL2, sOdf
Introduction TRANCE/OPGL/RANKL/ODF is a recently identified member of tumor necrosis factor family. TRANCE (TNF-related activation-induced cytokine receptor) or RANKL {receptor activator of NF-kB (RANK) ligand} has been implicated in interactions between T cells and dendritic cells. RANK ligand (RANKL/TRANCE) binds to RANK on dendritic cells, upregulates the expression of anti-apoptotic protein BcL-XL suggesting a role in dendritic cell survival. TRANCE/RANKL is also important in T and B-cell maturation. As OPGL/ODF (Osteoprotegerin Ligand/Osteoclast differentiation factor), the same protein can both activate mature osteoclasts and mediate osteoclastogenesis. OPGL/TRANCE deficient mice show severe osteoporesis and complete absence of osteoclasts as a result of lack of osteogenesis.
Product Details
Description Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 11. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
RefSeq ORF Size 954 bp
Sequence Information A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with NP_003692.1.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + NotI (6.1kb + 0.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.