TNFSF10 cDNA ORF Clone, Rhesus, N-Myc tag - CD BioSciences

service-banner

TNFSF10 cDNA ORF Clone, Rhesus, N-Myc tag

TNFSF10 cDNA ORF Clone, Rhesus, N-Myc tag

SPD-15161

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 10 with N terminal Myc tag.
Target Information
Species Rhesus
Target Name TRAIL
Gene Abbr. TNFSF10
Gene ID 694451
Full Name TNF superfamily member 10
Introduction Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), also referred to as Apo2 ligand, first identified based on its sequence homology to TNF and Fas/Apo ligand is a member of the TNF family of cytokines and either exists as a type II membrane or soluble protein. TRAIL induces apoptosis in a variety of transformed cell lines and plays a role in anti-tumor and anti-viral immune surveillance. TRAIL signals via binding with death receptors DR4 (TRAIL-R1) and DR5 (TRAIL-R2) which can trigger apoptosis as well as NF-κB activation. Death domains on these receptors leads to the recruitment of a death-induced signaling complex (DISC) leading to caspase-8 and subsequent caspase-3 activation. In addition, TRAIL binds with decoy receptors DcR1 (TRAIL-R3) and DcR2 (TRAIL-R4, TRUNDD) which lack the functional cytoplasmic death domain antagonizing TRAIL-induced apoptosis. Osteoprotegerin (OPG) has also been identified as receptor capable of inhibiting TRAIL-induced apoptosis. The selectivity of soluble TRAIL at triggering apoptosis in transformed cells as compared to normal cells has led to its investigation as a potential cancer therapeutic.
Product Details
Description Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 10 with N terminal Myc tag.
NCBI Ref Seq XM_001084768.2
RefSeq ORF Size 846 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.