Online Inquiry
TNFRSF6B cDNA ORF Clone, Human, N-His tag
SPD-14959
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 6b, decoy, transcript variant M68E with N terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TNF Receptor |
Gene Abbr. | TNFRSF6B |
Gene ID | 8771 |
Full Name | TNF receptor superfamily member 6b |
Alias | DCR3, DJ583P15.1.1, M68, M68E, TR6 |
Introduction | This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Overexpression of this gene has been noted in gastrointestinal tract tumors, and it is located in a gene-rich cluster on chromosome 20, with other potentially tumor-related genes. Two transcript variants encoding the same isoform, but differing in the 5' UTR, have been observed for this gene. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 6b, decoy, transcript variant M68E with N terminal His tag. |
NCBI Ref Seq | NM_003823.2 |
RefSeq ORF Size | 909 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 255A/G not causing the amino acid variation. |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Restriction Sites | HindIII + NotI (6kb + 0.91kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.