TNFRSF6B cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

TNFRSF6B cDNA ORF Clone, Human, C-Myc tag

TNFRSF6B cDNA ORF Clone, Human, C-Myc tag

SPD-14955

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 6b, decoy, transcript variant M68E with C terminal Myc tag.
Target Information
Species Human
Target Name TNF Receptor
Gene Abbr. TNFRSF6B
Gene ID 8771
Full Name TNF receptor superfamily member 6b
Alias DCR3, DJ583P15.1.1, M68, M68E, TR6
Introduction This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Overexpression of this gene has been noted in gastrointestinal tract tumors, and it is located in a gene-rich cluster on chromosome 20, with other potentially tumor-related genes. Two transcript variants encoding the same isoform, but differing in the 5' UTR, have been observed for this gene.
Product Details
Description Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 6b, decoy, transcript variant M68E with C terminal Myc tag.
NCBI Ref Seq NM_003823.2
RefSeq ORF Size 948 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 255A/G not causing the amino acid variation.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites HindIII + NotI (6kb + 0.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.