Online Inquiry
TNFRSF25 cDNA ORF Clone, Human, N-Myc tag
SPD-14950
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 25 with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TNF Receptor |
| Gene Abbr. | TNFRSF25 |
| Gene ID | 8718 |
| Full Name | TNF receptor superfamily member 25 |
| Alias | APO-3, DDR3, DR3, GEF720, LARD |
| Introduction | The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain. The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases.DR3/WSL-1/Apo-3/TRAMP/LARD is a TNFR family member containing the characteristic extracellular cysteine-repeats, transmembrane region, and an intracellular DD. DR3 is activated by its ligand Apo-3L/TWEAK to induce apoptosis and activation of NF-κB. Like TNF-R1, DR3 binds to the DD adaptor protein TRADD, which can then associate with other DD proteins like FADD and RIP as well as members of the TRAF family. Tissue expression of DR3 is very restricted, primarily seen on the surface of activated thymocytes and lymphocytes and plays an important role in thymocyte negative selection. Studies have also indicated an association with DR3 and rheumatoid arthritis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 25 with N terminal Myc tag. |
| NCBI Ref Seq | NM_148965 |
| RefSeq ORF Size | 1254 bp |
| Vector | pCMV3-SP-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.