Tnfrsf21 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Tnfrsf21 cDNA ORF Clone, Rat, untagged

Tnfrsf21 cDNA ORF Clone, Rat, untagged

SPD-14922

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 21.
Target Information
Species Rat
Target Name TNF Receptor
Gene Abbr. Tnfrsf21
Gene ID 316256
Full Name TNF receptor superfamily member 21
Introduction The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain. The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases.DR6, also known as TNFRSF21, is a TNFR family member able to induce apoptosis as well as activation of NF-κB and JNK. Expression of DR6 is upregulated by NF-κB signaling. DR6 appears to play a critical role in the activation and differentiation of T and B lymphocytes. In the nervous system, β-amyloid precursor protein (APP) activates DR6 to trigger neuronal degeneration.
Product Details
Description Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 21.
NCBI Ref Seq NM_001108207.1
RefSeq ORF Size 1968 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.