Online Inquiry
TNFRSF21 cDNA ORF Clone, Human, N-Myc tag
SPD-14930
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 21(TNFRSF21) with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TNF Receptor |
| Gene Abbr. | TNFRSF21 |
| Gene ID | 27242 |
| Full Name | TNF receptor superfamily member 21 |
| Alias | BM-018, CD358, DR6 |
| Introduction | The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain. The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases.DR6, also known as TNFRSF21, is a TNFR family member able to induce apoptosis as well as activation of NF-κB and JNK. Expression of DR6 is upregulated by NF-κB signaling. DR6 appears to play a critical role in the activation and differentiation of T and B lymphocytes. In the nervous system, β-amyloid precursor protein (APP) activates DR6 to trigger neuronal degeneration. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 21(TNFRSF21) with N terminal Myc tag. |
| NCBI Ref Seq | NM_014452.3 |
| RefSeq ORF Size | 1968 bp |
| Vector | pCMV3-SP-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.