Online Inquiry
TNFRSF1A cDNA ORF Clone, Rhesus, C-Myc tag
SPD-14865
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 1A with C terminal Myc tag. |
Target Information | |
---|---|
Species | Rhesus |
Target Name | TNF Receptor |
Gene Abbr. | TNFRSF1A |
Gene ID | 722033 |
Full Name | TNF receptor superfamily member 1A |
Introduction | TNF-α is an important cytokine produced by numerous cell types including neutrophils, activated lymphoctyes, macrophages and NK cells. It plays a critical role in inflammatory responses and in apoptosis. TNF-α exists as a membrane-anchored and soluble form, both of which show biological activity. Response to TNF-α is mediated through two receptors, TNF-R1, which is widely expressed, and TNF-R2, which is expressed mainly in immune and endothelial cells. Antagonists to TNF-α have been validated as therapeutic targets for rheumatoid arthritis and other immune disorders.The two receptors for TNF-α, TNF-R1 (55 kDa) and TNF-R2 (75 kDa) can mediate distinct cellular responses. In most cases cytotoxicity elicited by TNF has been reported to act through TNF-R1. Cytotoxicity is mediated by a "death domain" with the intracellular region of the receptor that binds to the death domain adaptor protein TRADD and triggers the activation of caspases. Soluble forms of both receptors have also been characterized which can bind TNF-α and may play an important role in immune disorders. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 1A with C terminal Myc tag. |
NCBI Ref Seq | XM_001118232.2 |
RefSeq ORF Size | 1044 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.