Tnfrsf1a cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Tnfrsf1a cDNA ORF Clone, Mouse, C-HA tag

Tnfrsf1a cDNA ORF Clone, Mouse, C-HA tag

SPD-14886

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse tumor necrosis factor receptor superfamily, member 1a with C terminal HA tag.
Target Information
Species Mouse
Target Name TNF Receptor
Gene Abbr. Tnfrsf1a
Gene ID 21937
Full Name tumor necrosis factor receptor superfamily, member 1a
Alias CD120, CD120a, FPF, TN, TNF-
Introduction TNF-α is an important cytokine produced by numerous cell types including neutrophils, activated lymphoctyes, macrophages and NK cells. It plays a critical role in inflammatory responses and in apoptosis. TNF-α exists as a membrane-anchored and soluble form, both of which show biological activity. Response to TNF-α is mediated through two receptors, TNF-R1, which is widely expressed, and TNF-R2, which is expressed mainly in immune and endothelial cells. Antagonists to TNF-α have been validated as therapeutic targets for rheumatoid arthritis and other immune disorders.The two receptors for TNF-α, TNF-R1 (55 kDa) and TNF-R2 (75 kDa) can mediate distinct cellular responses. In most cases cytotoxicity elicited by TNF has been reported to act through TNF-R1. Cytotoxicity is mediated by a "death domain" with the intracellular region of the receptor that binds to the death domain adaptor protein TRADD and triggers the activation of caspases. Soluble forms of both receptors have also been characterized which can bind TNF-α and may play an important role in immune disorders.
Product Details
Description Full length Clone DNA of Mouse tumor necrosis factor receptor superfamily, member 1a with C terminal HA tag.
NCBI Ref Seq NM_011609.4
RefSeq ORF Size 1407 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.41kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.