Online Inquiry
TNFRSF10D cDNA ORF Clone, Human, N-HA tag
SPD-14861
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | TNF Receptor |
Gene Abbr. | TNFRSF10D |
Gene ID | 8793 |
Full Name | TNF receptor superfamily member 10d |
Alias | CD264, DCR2, TRAIL-R4, TRAILR4, TRUNDD |
Introduction | Apoptosis is induced by certain cytokines including TNF and Fas ligand in the TNF family through their death domain containing receptors. TRAIL/Apo2L is a new member of the TNF family and induces apoptosis of a variety of tumor cell lines. DR4 and DR5 are the recently identified functional receptors for TRAIL, and DcR1/TRID is a decoy receptor. Another member of the TRAIL receptor family was more recently identified and designated DcR2, TRAIL-R4, or TRUNDD. DcR2 has an extracellular TRAIL-binding domain but lacks intracellular death domain and does not induce apoptosis. Like DR4 and DR5, DcR2 transcript is widely expressed in normal human tissues. Overexpression of DcR2 attenuated TRAIL-induced apoptosis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) with N terminal HA tag. |
NCBI Ref Seq | NM_003840.3 |
RefSeq ORF Size | 1161 bp |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.