Online Inquiry
TNFRSF10A cDNA ORF Clone, Rhesus, untagged
SPD-14821
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rhesus TNF receptor superfamily member 10a. |
| Target Information | |
|---|---|
| Species | Rhesus |
| Target Name | TNF Receptor |
| Gene Abbr. | TNFRSF10A |
| Gene ID | 716901 |
| Full Name | TNF receptor superfamily member 10a |
| Introduction | The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain. The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases.DR4 (TRAIL-RI, TNFRSF10A) and DR5 (TRAIL-R2, TNFRSF10B) are receptors for the cytokine TRAIL. Both receptors contain death domains that recruit DISC complexes triggering caspase activation and apoptosis. The ability of TRAIL to selectively kill malignant cells has led to clinical studies involving TRAIL and receptor agonists. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rhesus TNF receptor superfamily member 10a. |
| NCBI Ref Seq | XM_015144975.1 |
| RefSeq ORF Size | 1242 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1146G/A not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 1.24kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.