TNFRSF10A cDNA ORF Clone, Rhesus, N-FLAG tag - CD BioSciences

service-banner

TNFRSF10A cDNA ORF Clone, Rhesus, N-FLAG tag

TNFRSF10A cDNA ORF Clone, Rhesus, N-FLAG tag

SPD-14816

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain with N terminal Flag tag.
Target Information
Species Rhesus
Target Name TNF Receptor
Gene Abbr. TNFRSF10A
Gene ID 716901
Full Name TNF receptor superfamily member 10a
Introduction The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL). They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain. The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases.DR4 (TRAIL-RI, TNFRSF10A) and DR5 (TRAIL-R2, TNFRSF10B) are receptors for the cytokine TRAIL. Both receptors contain death domains that recruit DISC complexes triggering caspase activation and apoptosis. The ability of TRAIL to selectively kill malignant cells has led to clinical studies involving TRAIL and receptor agonists.
Product Details
Description Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain with N terminal Flag tag.
NCBI Ref Seq XM_001107922.1
RefSeq ORF Size 1149 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.