TNFAIP3 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

TNFAIP3 cDNA ORF Clone, Human, N-HA tag

TNFAIP3 cDNA ORF Clone, Human, N-HA tag

SPD-00274

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tumor necrosis factor, alpha-induced protein 3 with N terminal HA tag.
Target Information
Species Human
Target Name A20/TNFAIP3
Gene Abbr. TNFAIP3
Gene ID 7128
Full Name TNF alpha induced protein 3
Alias A20, AISBL, OTUD7C, TNFA1P2
Introduction A20, also referred to as TNF-α-induced protein 3 (TNFAIP3), is cytokine-inducible protein that functions to inhibit apoptosis and activate NF-κB. It was first identified as a TNF-α inducible primary response gene in human umbilical vein endothelial cells, and encodes a 790-amino acid protein containing seven Cys2/Cys2-zinc finger motifs. Constitutive expression of A20 is observed in lymphoid tissues but it is transiently expressed in a variety of cell types in response to inflammatory signals such as TNF-α, IL-1, phorbol esters and LPS. Expression of A20 can confer resistance to apoptosis and NF-κB activation triggered by these signals, probably through interference with TRAF (TNF receptor associated factor) family members, and interaction with the NF-κB inhibiting protein ABIN. Studies also show that A20 contains site-specific ubiquitin modifying activity that can contribute to its biological functions. The amino-terminus of A20 contains de-ubiquitinating (DUB) activity for Lys63 branches, such as those found in TRAF6 and RIP, while the carboxyl-terminus contains ubiquitin ligase (E3) activity for Lys48 branches of the same substrates and leads to their degradation.
Product Details
Description Full length Clone DNA of Human tumor necrosis factor, alpha-induced protein 3 with N terminal HA tag.
NCBI Ref Seq NM_006290.2
RefSeq ORF Size 2415 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 2.42kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.