Online Inquiry
TNFAIP3 cDNA ORF Clone, Human, C-Myc tag
SPD-00268
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human tumor necrosis factor, alpha-induced protein 3 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | A20/TNFAIP3 |
Gene Abbr. | TNFAIP3 |
Gene ID | 7128 |
Full Name | TNF alpha induced protein 3 |
Alias | A20, AISBL, OTUD7C, TNFA1P2 |
Introduction | A20, also referred to as TNF-α-induced protein 3 (TNFAIP3), is cytokine-inducible protein that functions to inhibit apoptosis and activate NF-κB. It was first identified as a TNF-α inducible primary response gene in human umbilical vein endothelial cells, and encodes a 790-amino acid protein containing seven Cys2/Cys2-zinc finger motifs. Constitutive expression of A20 is observed in lymphoid tissues but it is transiently expressed in a variety of cell types in response to inflammatory signals such as TNF-α, IL-1, phorbol esters and LPS. Expression of A20 can confer resistance to apoptosis and NF-κB activation triggered by these signals, probably through interference with TRAF (TNF receptor associated factor) family members, and interaction with the NF-κB inhibiting protein ABIN. Studies also show that A20 contains site-specific ubiquitin modifying activity that can contribute to its biological functions. The amino-terminus of A20 contains de-ubiquitinating (DUB) activity for Lys63 branches, such as those found in TRAF6 and RIP, while the carboxyl-terminus contains ubiquitin ligase (E3) activity for Lys48 branches of the same substrates and leads to their degradation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human tumor necrosis factor, alpha-induced protein 3 with C terminal Myc tag. |
NCBI Ref Seq | NM_006290.2 |
RefSeq ORF Size | 2418 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 2.42kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.